Chronological Lab Notebook

Bowl looked cloudy (unusual). Collected a few drops delicately.
Cloudy, particulates.
pH >=7 ish by the look of it.
Particles?
PLM: birefringence!
A drop of vinegar in 100ul -> clears right up
A few grains of NaOH in vial: cloudy -> vinegar -> clear (bubbles)
Likely calcium phosphate (or other calcium/magnesium salts).
I did drink an LMNT in last 24h?
Monitoring the situation :) REFUSE to be that kind of mad scientist and collect further samples

Bought some melting point capillaries
Easy to scribe a line and snap w/ diamond cutting bit
Easy to flame pull to get some insanely tiny tubes, <0.1mm
Nice for fluorescence w/o/ the background flourescence the PCR tubes give
attached nicely to 10uL pipette tip, easy to suck up a sample

NADH has nice strong fluorescence
NAD+ doesn't
BUT NAD+ capsules came with 'microcrystalline cellulose' as an extra ingredient, and showed strong lingering RTP (video on this date)
One capsule in ~4ml water, settled (some top scum some bottom crud). Filtered clear middle liquid through .22um, about 2ml each. NADH 20mg/pill so ~10mg in 2ml vial, NAD+ 1000mg in pill so saturated, I est 100mg/ml? But who knows.

Noticed ice formed on a slide (cooled with some dry ice) from liquid with DNA in it (both strawberry DNA extract and some plasmid) had particularly lovely colors. Don't think the DNA or salts were needed, BUT probably made for some unique crystal growth. Lots of footage in my camera roll

Cooling a green LED with dry ice then watching the spectra

Nice piece of kit! Very clear mercury doublet (2nm apart at 577/579nm).

Borrowed a thermocycler to run some PCR
White vs Orange poppy (see https://ln.johnowhitaker.com/entry/39) and barcoding leaf miner moth (intro in https://ln.johnowhitaker.com/entry/83, inat observation where I photographed the adult https://www.inaturalist.org/observations/404178324 fun fact Phyllocnistis occidentalis described this year, ID by author)
Primer Sequence (5′→3′)
LepF1 ATTCAACCAATCATAAAGATATTGG
LepR1 TAAACTTCTGGATGTCCAAAAAATCA
PSY-Gap-F TCAAGCAACGACGGAGAGTA
PSY-Gap-R CCTTGCCTGCGAATATGTCT
Approach:
Tissue was preserved in Zymo DNA shield
Small piece (<2mm) was washed with water then put in 50uL DPX and mashed up
2ul extract + 12.5ul 2X master mix + 8.5uL water + 2uL primer mix (primers: diluted to 100nmol/mL then 10ul F and 10ul R + 180uL water)
94C 30s, 52C 40s, 72C 60S x 40, 72C 5min, 4C

Also trying 1/10 dilutions (ish - I just put 2ul from the full-conc mix into the extract-less 2nd tube marked /10)

I did one PCR run just on poppies but didn't mash em up, got a band for white poppy but not the others (pic, ladder stretched by 2 runs so ignore). 54C not 52 (52 is compromise, I think moth protocol is 50 or lower?)

Ran gel w/ 2% agarose, 40ml agarose, ~30ml TBE above, 50V over 8cm,. ran 6am Saturday morning. Lovely results!

O is clearly lagging behind W (the /10 extraction worked for both, so there was prob. too much inhibitor in the raw extracts). I belatedly thought to add 2.5ul of W/10 and 2.5ul of O/10 to the right-most lane, and got a nice bouble-band for my trouble, so cool!

Short on this coming soon

Extracted some strawberry DNA and let some dry looking for interesting LCD-ish arrangements, got some sheets/bubbles (not sure if DNA or just detergent, but pretty sure DNA?). Anyway I just liked how it looked

Using some silica, mixed (mostly failed) results:
- Making a slurry first is a better way to get packing
- Small tubes are cool but tricky in that any air bubbles above the column are hard to clear and tend to mess things up
- Need 10-20X column volume at least, so smaller is better re: solvent waste
- Pushing air through was always bad
- I had channeling issues in general, and edge seepage (made up term?) in the thin column, maybe because flexible tube under pressure?
- Solvent messing: mineral spirits with variable ethyl acetate, then tested with water for things where I was worried about getting sprayed haha
- bibilous paper as filter seemed to work OK, for bigger one I used miniprep column.
- TODO hook up a fluorescent readout once spec arrives, try on TLC plates and pick a nice model system + solvent mix, try a scaled up one and get used to 10s of mls of solvent rather than being stingy

Volcanic rock yey

From the edge of a silk retreat made by this jumping spider, 4x and 10x (20x eye)

On the 26th I streaked some bacteria growing round a sink plug (pink). Suspect: Serratia marcescens. It grew out nicely (kept it warm). Today I did gram stain (gram -ve) and catalase +ve. I stuck a loopful in DNA shield in case I feel like sequencing them later, but S. m. seems likely. Leaving now at room temp to see if growing some out cooler leads to color, TIL s.m. goes pale when incubated warm.

Leaf miners in our grapes turn out to be the (described in 2026) Phyllocnistis occidentalis, judging by the thin line of frass (https://bugtracks.wordpress.com/2026/08/28/grappling-with-grape-leafminers, my inat: https://www.inaturalist.org/observations/404178324). I'm thinking about barcoding them to check, as a fun PCR excuse.
Leaf miner moth leaf bits in vial with parafilm. After a few days I noticed the film bowed inward, I thought parafilm let air diffuse through but maybe the O2 is being consumed (w/ CO2 dissolving in leaf tissue) faster than more can diffuse in? ANyway, poked some tiny holes to let p equalize, hopefully the tiny moths don't get out before I can smush em.
We had some pink something in one downstairs sink, just around the plug hole. I suspect Serratia marcescens , culturing some to investigate. Nice colonies so far.
I tried a heat shock transform of agrobacterium, got lots of colonies on the firs plate (suspiciously many, was expecting a handful at best). I streaked a few on new plate, no colonies even after a while apart from one blob near the start of streak #3. Hmm. Too many variables and guesswork, I might need to restart from known agro strain and use electroporation. Bummer for the project. Will try streaking a few more Cs but don't feel like making a whole lot more plates.

4W blue laser diode on kapton tape. High surface area, most traces ~500 ohms / cm (freehand first test, with appropriate safety goggles). I suspect doing this in a more controlled way (3D printer mount + control soon), plus adding other materials e.g. layered on top or incorporated in, would make for a very cool way to construct self-heating catalyst sheets that can heat to hundreds of degrees and be used for various catalysis stuff! Some experiments planned. Also, lots of other fun stuff in store for this laser

Not many bits survived the process but I have one especially good-looking callus going with signs of red RUBY and signs of the purple anthocyanins going.

Things that should get a ln but haven't this past week

Notably modelled and printed by Astra with no oversight, then painted and put out

0.5% Cr2O3 in Aluminium oxide, carbon arcs with a welder set to ~70A. Nice glow under UV, some pinkish color but lots of black/grey/brown too, nice red under UV

Sadly, despite a last desperate bleach-related rescue attempt, my possibly-miraculin-transformed duckweed fronds are overcome with mold.